Fig 1: Expression of GPR87 in accumulated basal progenitor cells within the idiopathic pulmonary fibrosis (IPF) lung. a) Uniform manifold approximation and projection (UMAP) visualisation shows unsupervised transcriptome clustering, revealing nine distinct cell clusters. Heatmap shows the highest expressed marker genes of each cluster. b) UMAP visualisation showing distribution of healthy donor and IPF cells to different clusters. c) Volcano plot of differentially expressed genes (red, log2 fold change (FC) >0.6, q<0.05) in IPF EpCAM+ epithelial cells compared with donor samples, zooming in gene sets with top-15 fold change and top-15 fold change genes related to transmembrane signalling receptor activity (GO:0004888). d) Heatmap of transmembrane signalling receptor genes robustly regulated in the (supra)basal cell population across all individual tissue samples. Dotplots show GPR87 expression in our (e) and another two publicly available datasets [6, 8] (f), respectively. g) GPR87 mRNA was detected by RNAscope (Advanced Cell Diagnostics, number 471861) and combined with fluorescent immunolabelling of basal cell markers KRT5 and KRT17 in IPF lung sections (n=6) (KRT5: Biolegend 905901; KRT17: Abcam ab51056) Top row: lower magnification of a distal lung area with several remodelled airways (scale bar: 200 μm). Higher magnification of a representative cyst and a bronchiole are presented below in higher magnification (scale bar: 20 μm). KRT5+/KRT17+/GPR87+ cells are indicated by arrowheads. KRT5−/KRT17+/GPR87+ cells are indicated by open triangles. Non-cellular staining is marked by an asterisk. h) Lung tissue sections of IPF (n=3) and healthy donor (n=2) were co-immunolabelled for GPR87 (Novus Biologicals NBP2-16728) and KRT5. Nuclei are visualised by DAPI staining. Protein expression of GPR87 alone is shown in subpanel (i) and co-immunolabeled with KRT5 in (ii). Two more representative areas of remodelled airways with merged protein expression are shown in (iii) and (iv). Representative double positive cells for respective markers are indicated by arrowheads. Scale bar: 50 µm. i) Scheme of primary human bronchial epithelial cell (HBEC) isolation and air–liquid interface (ALI) culture (reproduced from Servier Medical Art (smart.servier.com) with permission). HBECs were isolated from healthy donors (n=3) and cultured on rat-tail collagen type I under submerged conditions, either transduced with lentivirus (empty vector (Origene, PS100092) or human GPR87 ORF (Origene, RC218486L3)) (m), and/or directly transferred and cultured on collagen type IV membranes, airlifted (day 0) and differentiated to a mature epithelium within 21 days. Transforming growth factor (TGF)-β treatment (R&D, 240-B-002, 2 or 4 ng·mL−1) was performed at day 21 and every other day till day 28 (four times in total) (k). Shown are phase contrast images for dish cultured cells and early ALI (left, middle; scale bars: 250 μm, 100 μm), and a confocal image of acetylated tubulin (acTub) (Abcam ab24610) to visualise late ALI (mature epithelium, right; scale bar: 25 μm). j) Vertical membrane sections of mature ALI cultured HBECs were immunolabeled for GPR87, basal cell marker KRT5 and secretory cell marker MUC5AC (Abcam ab3649) (n=2). Representative double positive cells for respective markers are indicated by arrowheads. Scale bar: 25 µm. (We also observed cilia staining, as indicated by open triangles, and based on our single cell dataset ciliated cells might also express GPR87.) k) Airlifted donor HBECs were stimulated with low (2 ng·mL−1) and high (4 ng·mL−1) concentrations of TGF-β, as described in (i). GPR87 gene expression was assessed by qPCR in five independent donor cell lines. GAPDH was used as an housekeeper gene control (huGPR87-fw (ACCTATGCTGAACCCACGC), -re (CCGTGCAGCTCGTTATTTGG); huGAPDH-fw (ACTAGGCGCTCACTGTTCTC), -re (AATACGACCAAATCCGTTGACTC)). Two-tailed Mann–Whitney test was performed to determine statistical significance. **: p<0.01. n=5. l) Functional annotation enrichment analysis of GPR87 positive correlated genes reveals several categories of airway remodelling. m) HBECs were transduced with lentivirus containing the full ORF of GPR87 to generate a stable overexpression of GPR87 (GPR87-over). Empty backbone-vector alone was used as a control (vector). Cells were cultured on ALI till day 21 and co-immunolabelled for acTub and FOXJ1 (Invitrogen 14-9965-82). DAPI and phalloidin stainings were performed to visualise nuclei and cellular integrity. Cells with no/shortened cilia are indicated by arrowheads. Representative images of n=4 are shown. Scale bar: 25 µm. Areas covered by cilia were quantified with ImageJ [17]. Two-tailed Mann–Whitney test was performed to determine statistical significance.
Fig 2: Study of the effect of ILs on the differentiation process after wound closure. a Diagram of well cutting and immunolabeling made in the three different thirds of wells (CK14 in the upper third, MUC5AC in the intermediate third and ATA in the lower third) and method of analysis: Effects of ILs on differentiation in HNEC cultures after wound closure (2 (F2), 7 (F7) and 12 (F12) days after wound closure) was characterized by immunolabeling: each well was separated in three areas for each immunolabeling marker before IL-staining in order to avoid mixed antibodies contaminations (by cutting each well in three areas): either with mouse monoclonal anti-cytokeratin 14 (CellMarque 314 M-14, 1/100) (picture a-1) as a basal cell marker, mouse monoclonal anti-mucin-5AC (Abcam ab3649, 1/200) (picture a-2) as a goblet cell marker, or mouse monoclonal anti-acetylated α-tubulin (Abcam ab24610, 1/500) (picture a-3) as a ciliated cell marker, before being revealed by a secondary goat anti-mouse Alexa Fluor- 488 antibody (Molecular Probes 1/500). Nuclei were stained by DAPI. In order to evaluate the “wound” effect and overcome the IL effect on healthy epithelium, we measured the ratio of the number of nuclei stained by DAPI or the percentage of cells positive for each immunolabeling (ATA, MUC5AC, and CK14) in two wounded areas on the number of nuclei for the DAPI in the corresponding two non-wounded control areas of the same well. b–e Comparison of ratios (percentage of positive cells in wounded area/Percentage of positive cells in non-wounded control areas) after 2, 7 and 12 days after wound closure between culture wells modulated by each IL (IL-5, IL-6, IL-9, IL-10) and not (controls wells). b Comparison of nuclei ratios (wounded areas/non-wounded areas) between culture wells with IL and without *p < 0.05. c Comparison of ciliated cell ratios (wounded areas/non-wounded areas) between culture wells with IL and without *p < 0.05. d Comparison of goblet cell ratios (wounded areas/non-wounded areas) between culture wells with IL and without *p < 0.05. e Comparison of basal cell ratios (wounded areas/non-wounded areas) between culture wells with IL and without *p < 0.05
Supplier Page from Abcam for Anti-alpha Tubulin (acetyl K40) antibody [6-11B-1]